ࡱ> ` y'bjbjss BXT???8&@Tz@lFz@AAA@ABC\JD0z!z!z!z!z!z!z$|h~*EzVKBBVKVKEzA@AZz|M|M|MVK4ARA(z|MVKz|M|Mnipf"5lA@ j֮?Kk tpz0zkLN@5lClzDVE|MFGzDzDzDEzEz`MzDzDzDzVKVKVKVKFFF&>FFF>4" Jiro Takamisawa 1 June 2006 By email Same Sex Inquiry, Human Rights Unit Human Rights and Equal Opportunity Commission GPO Box 5218, Sydney NSW 2001  ADVANCE \y 300 Dear Sir/Madam Veterans' pensions and entitlements My name is Jiro Takamisawa. I am a man. I met my partner, John George, in Tokyo, Japan in September 1984. We began a loving relationship that endured until John died in 2004. Background In May 1986, I applied for permanent residence status in Australia on the basis of my relationship with John. I was granted permanent residence status in Australia in January 1990. John served with the Australian Defence Force during World War Two. John later developed ischaemic heart disease. The Veterans Review Board accepted his heart disease was connected to his war service. As a result, while John was alive, he received a disability pension. I received a carers allowance from Centrelink in recognition that I was the primary carer for John from March 2000 until the time of John's death on 10 October 2004. John died from his ischaemic heart disease. Application for pension On 16 December 2004, I applied to the Department of Veterans Affairs (the Department) for a pension as a dependent of a deceased veteran. My application was determined by a delegate of the Repatriation Commission. On 20 January 2005, the Department informed me that the Repatriation Commissions delegate had decided to grant me a war widow's pension with effect from 11 October 2004. The letter from the Department addressed me as Miss Takamisawa, assuming that I was a woman. I had not been required to state my gender on the form. I asked a friend to contact the Department and to advise the Department that I was, in fact, a man not a woman. I received a letter from the Department dated 21 January 2005, advising me that the Repatriation Commission delegate had decided to revoke the grant of the pension to me because I was not entitled to the pension after all. I was not entitled to the pension because I am a man, and I was in a same sex relationship with John. The delegate wrote that under the Veterans Entitlements Act 1986 (Cth), you are not regarded as the late veterans dependant and the delegate is unable to exercise any discretion in this matter. The relevant parts of the Veterans Entitlements Act 1986 are as follows: Section 5E(1) defines a partner. It states: partner in relation to a person who is a member of a couple, means the other member of the couple. Couple is relevantly defined in section 5E(2) as: A person is a member of a couple for the purposes of this Act if: (a) the person is legally married to another person and is not living separately and apart from the other person on a permanent basis; or (b) all of the following conditions are met: (i) the person is living with a person of the opposite sex (in this paragraph called the partner On 13 April 2005, I appealed against the decision to revoke the pension. On 10 August 2005, I attended a hearing before the Veterans' Review Board. By letter dated 17 August 2005, the Veterans' Review Board made its decision. The Veterans Review Board made the following comments: The Board has no hesitation in finding that the Veteran's death was war caused. The Board took the view that there was clearly sufficient indicia of a marriage-like relationship. The applicant would be entitled to be considered as a dependant of the late veteran, were it not for the fact that the applicant and the veteran were of the same sex. It is for this reason alone, in accordance with the current legislation that his application has failed. The Board must find the applicant does not meet all the criteria. In this the Board has no discretion. In these circumstances the Board has no option but to affirm the decision under review. Other steps I took other steps. On 23 February 2005, I wrote to the Honourable De-Anne Kelly MP who was, at that time, the Minister for Veterans Affairs. She wrote back to me by facsimile dated 22 April 2005. She wrote that: the Government considers that the current eligibility criteria for the war widows/ers pension are fair and reasonable. Therefore, it has no plans to change the legislation to amend the definition of member of a couple to include same sex partners. I approached the office of my Federal Member of Parliament, the Honourable Tanya Plibersek MP. Tanya spoke to the media about my story. She sent letters to the Honourable Philip Ruddock MP, Attorney-General, and the Honourable De-Anne Kelly MP, then Minister for Veterans Affairs (28 April 2005). The Attorney-General replied by letter dated 2 June 2005 that: The Government condemns discrimination in all its forms, including discrimination on the basis of sexuality. The Government believes that each of us should have the opportunity to participate in the life of our community and to experience the benefits and accept the responsibilities that flow from such participation without fear of discrimination. The Government is committed to maintaining the Australian traditions of tolerance and respect for diversity, which are the foundations of one of the worlds most successful multicultural societies. However, the Government does not consider that every distinction on the basis of sexual preference is illegitimate or would constitute discrimination in international human rights law. The criteria for receiving a War Widows Pension in the Veterans Entitlement Act 1986 is a case in point. I also asked my lawyers, Gilbert + Tobin, to make a complaint to the Human Rights and Equal Opportunity Commission (HREOC) and to request HREOC to exercise its powers under section 11(1)(e) of the Human Rights and Equal Opportunity Commission Act 1986 (Cth) to examine the Veterans Entitlements Act 1986 (Cth) to determine whether it is inconsistent with or contrary to the human right of equal treatment before the law provided by Article 26 of the International Covenant on Civil and Political Rights. They did so by letter dated 15 December 2005. HREOC responded by letter 5 April 2006. HREOC declined to investigate the complaint on the basis that there was no relevant act or practice by the Commonwealth since there was no exercise of discretion by any decision maker. HREOC also declined to examine the Veterans Entitlement Act 1986 to determine if it was inconsistent with or contrary to any human right. HREOC said that: As the Commission is already conducting an inquiry into the entitlements of people in same sex relationships, it has therefore decided not to exercise its power pursuant to section 11(1)(e) of the HREOCA. How I feel Throughout this process, my concern was to be treated equally. I just want to be treated like everyone else. If I could get the pension as a woman who loved a male veteran, shouldnt I be entitled to the pension if I loved a male veteran as a man? I want to be acknowledged as Johns partner and lover, and to be treated consistent with that status. If I was a woman in a relationship with John, I would have been entitled to the pension. However, since I was in a same sex relationship, I was automatically excluded by reason of the legislation. To me, that is very unfair and it is wrong. It is an arbitrary distinction to draw that doesnt respect the legitimacy or the strength of the relationship I had with John. [Details removed] Yours faithfully Jiro Takamisawa     PAGE 1 Gilbert+Tobin 2 Park Street Sydney NSW 2000 Australia GPO Box 3810 Sydney NSW 2001 T+61292634000 F+61292634111 DX10348SSE  HYPERLINK "http://www.gtlaw.com.au" www.gtlaw.com.au Gilbert+Tobin 2 Park Street Sydney NSW 2000 Australia GPO Box 3810 Sydney NSW 2001 T+61292634000 F+61292634111 DX10348SSE  HYPERLINK "http://www.gtlaw.com.au" www.gtlaw.com.au !%&+/0 ( ) ׺׍׮{m{_{m{h20B*^JnH phtH hupB*^JnH phtH h2 B*^JnH phtH hF hx*h:`hzjhzU hivNhSt hSthSth:`ht'hivN huph4Jh2 hhR:h/k h/hihuphL4h7 hC"h$h1+h@LCJaJh1+h$CJaJ%&8Jxgdygd+!gd5>gdStgde4gdR:gdt'N]Ngdh] J N]Ngdh]l%0gdYKgdXgd;0@%<%%x') L  C a e } ~     * , 2 7 E Z p r w y  Ųzlllllllllh+(rB*^JnH phtH hB*^JnH phtH h/B*^JnH phtH h20B*^JnH phtH hdwB*^JnH phtH $hKhK5B*^JnH phtH hK5B*^JnH phtH h2 B*^JnH phtH h4rB*^JnH phtH hupB*^JnH phtH & T U d e 8 9 Q ( ) kl45abA7d7$8$H$^7gd/ d7$8$H$gdup  . / 9 P Q p ' < L 2jkl>?!Dշǔǃ!h+(rh+(rB*^JnH phtH h+(r5B*^JnH phtH $hKhK5B*^JnH phtH hK5B*^JnH phtH h+(rB*^JnH phtH hupB*^JnH phtH h/B*^JnH phtH hrB*^JnH phtH /Dd#34a&2Z[mo(1_vwԆxxxeRe$h+(rh+(r6B*^JnH phtH $h+(rhup6B*^JnH phtH h+(rB*^JnH phtH hrB*^JnH phtH h/B*^JnH phtH hB*^JnH phtH $h/h/6B*^JnH phtH !h/56B*^JnH phtH hupB*^JnH phtH h/B*^JnH phtH h/6B*^JnH phtH AZwx<> 7d7$8$H$^7gd d7$8$H$gd$7d7$8$H$^7gd+(r d7$8$H$gdupd7$8$H$^`gd/nd7$8$H$^n`gd/rs ;<>Q  ʺyfXJh6B*^JnH phtH huP>6B*^JnH phtH $huP>huP>6B*^JnH phtH hz B*^JnH phtH GHno:!;!" ""$$$$% % % % % % d7$8$H$gdup7d7$8$H$^7gd7d7$8$H$^7gdS@ d7$8$H$gd$ Y (!9!:!"" "ѲvhXE$hh6B*^JnH phtH h6B*^JnH phtH hB*^JnH phtH hB*^JnH phtH hVK6B*^JnH phtH hVKB*^JnH phtH hgvy5B*^JnH phtH hgvyB*^JnH phtH !hmhmB*^JnH phtH hmB*^JnH phtH hjxB*^JnH phtH $hz hz 6B*^JnH phtH  """-"R" # #r#{###6$7$$$$$$% % %ϥϗ{m_mQmCh/kB*^JnH phtH h?uB*^JnH phtH h@B*^JnH phtH hupB*^JnH phtH hkiB*^JnH phtH hdB*^JnH phtH hjiB*^JnH phtH h|B*^JnH phtH h?B*^JnH phtH hjxB*^JnH phtH h$B*^JnH phtH $hz hz 5B*^JnH phtH hz 5B*^JnH phtH  % %%% %!%#%$%&%'%.%/%5%6%7%8%9%;%<%%%%%%o&p&&&&&&&&ͼ׸״ןxiRxixi,jh.hkB* U^JaJph\h.hkB* ^JaJph\&jh.hkB* U^JaJph\%h.hkB* OJQJ^JaJph\(h.hk5B* OJQJ^JaJph\h:`h-k1hk0JmHnHu hk0Jjhk0JUhkjhkUhupB*^JnH phtH hB*^JnH phtH %%% %"%#%%%&%(%)%*%+%,%-%.%9%:%;%<%=%>%?%@%A%gd:`h]hgdy4 &`#$gdDgdu?` gdX"@ d7$8$H$gdupA%B%C%D%E%F%G%H%I%J%K%L%M%N%O%P%Q%R%S%T%U%V%W%X%Y%Z%[%\%]%gd:`]%^%_%`%a%b%c%d%e%f%g%h%i%j%k%l%m%n%o%p%q%r%s%t%u%v%w%x%y%gd:`y%z%{%|%}%~%%%%%%%%%%%%%%%%%%%%%%%%gd:`%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%&&& 4!gdU@A> 7, Hyperlink>*B*OJQJphFOF X Letter_Date  5B*phF)@aF y Page Number5B*CJOJQJph2B@r2 X$ Body TextDOD mxSubjectd5B*OJQJph\O\ mx Letter_top  S@Sd^S` B*CJph<<  i Table Grid:VdFOF u Date_Letter  5B*ph:O: mxLetter_top CharCJ4O4 (Signoff $d@Or@ rkDelivery  5B*ph8O8 mxStatusd B* ph\.O. mx Addressee 8K@r8 mx Salutation !@0@q"@ Vd List Bullet" & FdL6@q2L Vd List Bullet 2# & F7d^7pO!Bp 2OpPrec List Bullet1$ & F 0d<<^`0CJbOARb 2OpPrec List Bullet 2#% & F 70^`04a4Y+ G+T Bullets& Fs  G+T Table:V'0jg 'd<<m$OJQJ5CJOJQJD1@D _ List Number( & Fd2Or2 MEHeading ) & F8O!r8 ME Subheading * & FBB=QG+T List Numbering+ F $-6?GOW_ekquy}y          $-6?GOW_ekquy}     yyX + + +pyp&8JxTUde89Q()kl4 5 a b A Z w x <> GHno:;      ,zp#jp#Rp#PSp#PSp#PSp#PSp#PSp#PSp#PSp#PSp#PSp#PSp#PSp#PSp#v:p#:p#PSp#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v: p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#v:p#PS&8JxTUde89Q()kl4 5 a b A Z w x <> GHno:;       "#%&()*+,-.9:;<=>?+;<N`ano%&34nopqrstuvwz0000 0 0 0 0 0 000000!000000000000000000000000000000000000000000000000000000000000000000000000000000@0@0@0@0@0@0@000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000h0X0000000000000000000000000000000000000000h0h0 #&)<zh00h00h00h00H h0h0 !)  D " %&y' !*A %A%]%y%%%%&n'y'"#$%&'()+x'yT!!OvXX  >*/X2$yTlGh_1R$w~1VG5 v@P 0(  )0(  B S  ?y! cboPartnerDate cboDeliverytxtNumberofFaxPages Addressee AddresseeTemptxtNumberOfPages lstStatus Salutation txtSubjectBody!&z !&zNhldNhDcNhNhZNh,#NhLJ Nh\bNhNhgNhDNh)Nh4Nhd&NhT|OhTNOh|Oh̸OhOh Oh$6OhOhOhF Oh4}||--499T, ^  !5z     299BB d;k  1@z :*urn:schemas-microsoft-com:office:smarttagsStreet8*urn:schemas-microsoft-com:office:smarttagsCity8*urn:schemas-microsoft-com:office:smarttagsdate;*urn:schemas-microsoft-com:office:smarttagsaddressB*urn:schemas-microsoft-com:office:smarttagscountry-region9*urn:schemas-microsoft-com:office:smarttagsplace E110111213151617220200420052006212223284568DayMonthYear                <z= @ c j E H ,<B<z:::::::::%AAW R  r6    "#%&(),,--.9;<ssz<z ^#$(`8Bf<  oH- J1N倘X3{7GTCI (F(H`"XP $wg܀FuFlw~t%7^`OJQJo(hH-0^`0.7^`OJQJo(hHh77^7`OJQJo(hHhnn^n`OJQJo(hH-h nn^n`o(hHh nn^n`o(hHh nn^n`o(hHh nn^n`o(hHh nn^n`o(hHh nn^n`o(hHh nn^n`o(hH hh^h`hH) ^`hH) 88^8`hH) ^`hH() ^`hH() pp^p`hH()   ^ `hH. @ @ ^@ `hH.   ^ `hH. hh^h`hH) ^`hH) 88^8`hH) ^`hH() ^`hH() pp^p`hH()   ^ `hH. @ @ ^@ `hH.   ^ `hH.77^7`B*o(phhH77^7`56o(hH() n^n`o(hH n^n`o(hH n^n`o(hH n^n`o(hH n^n`o(hH n^n`o(hH n^n`o(hH77^7`B*o(phhHn7^n`56o(hH() n^n`o(hH n^n`o(hH n^n`o(hH n^n`o(hH n^n`o(hH n^n`o(hH n^n`o(hH 77^7`o(hH 77^7`o(hH. 77^7`o(hH() n7^n`o(hH()7^`CJOJQJaJo(hH() ^`o(hH ^`o(hH ^`o(hH ^`o(hH77^7`OJQJo(hH^`OJQJ^Jo(hHopp^p`OJQJo(hH@ @ ^@ `OJQJo(hH^`OJQJ^Jo(hHo^`OJQJo(hH^`OJQJo(hH^`OJQJ^Jo(hHoPP^P`OJQJo(hH^`OJQJo(hH^`OJQJo(hHopp^p`OJQJo(hH@ @ ^@ `OJQJo(hH^`OJQJo(hHo^`OJQJo(hH^`OJQJo(hH^`OJQJo(hHoPP^P`OJQJo(hH 77^7`o(hH() nn^n`o(hH()^`B*CJaJo(phhH() ^`o(hH ^`o(hH ^`o(hH ^`o(hH ^`o(hH n^n`o(hH77^7`OJQJo(hH-^`OJQJo(hHopp^p`OJQJo(hH@ @ ^@ `OJQJo(hH^`OJQJo(hHo^`OJQJo(hH^`OJQJo(hH^`OJQJo(hHoPP^P`OJQJo(hHwgXPFlw`8GTCGTCGTCGTCGTCGTCGTCGTCoH-< J1X3X3(F 4r         (8B        Bl         @mVxdD%t6y}#oC FWhkKv z F `M  F x  D c (O  @<?mK#7h \.BK~s[e}3AlSt/} 0:J],AnKuP>Iu>u?S@X"@;0@_H@!B&SC[CtCDMEkxE}EFaFNKGp HfHj?IJ:^JmjJVKYK[KL@LFM7MDMNtNivNQ]NQe3RHSSATKTxT^VkdVdWxX{XpYQ~Yf#Z["[B\~\h]"]4]T]a]L"^j^__{R4r;~B\]0Mm!:MN=Q8boq.R:?9PR/c)4L]J7C4G:?j7?Xhg)qgm0AnyW.| -ZVFav-TSK7i ANCSW}|x"'?@L+[ 4[$mX)$"?-{./VVd*5c9X6cGknuy7UIn &cv 9W1v.L$/ @Iu1dND56U )5>@!L\z:=bmi; z t1;y@(<O%9K8\ GtL]PIK%iZL{-8j(Cb9nDs"%(*+,-;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~noqrsz@fEyP@UnknownGz Times New Roman5Symbol3& z Arial=Arial Bold5& zaTahoma?Wingdings 2?5 z Courier New;Wingdings"q7hç&ç& &*8*8!d24du=2QX)0Eia2@   &   + Oh+'0d    , 8DLT\ Normal.dot4Microsoft Office Word@@5Ă@Z֮@Z֮*՜.+,D՜.+,d   8  Title 8@ _PID_HLINKSA _http://www.gtlaw.com.au/_http://www.gtlaw.com.au/  !"#$%&'()*+,./012346789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstvwxyz{|~Root Entry Fhm֮Data -1Table5XWordDocumentBXSummaryInformation(uDocumentSummaryInformation8}CompObjq  FMicrosoft Office Word Document MSWordDocWord.Document.89qRoot Entry Fv%Data -1Table5XWordDocumentBX՜.+,D՜.+,d   8  Title 8@ _PID_HLINKSA _http://www.gtlaw.com  !"#$%&'()*+,./012346789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstvwxyz{|.au/_http://www.gtlaw.com.au/SummaryInformation(uDocumentSummaryInformation8CompObjq